Just fill in the form below, click submit, you will get the price list, and we will contact you within one working day. Please also feel free to contact us via email or phone. (* is required).

cheap qizhenzengmiankeli for swine eperythrozoon disease

  • China Cow Medicine, Cow Medicine Manufacturers,

    China Cow Medicine manufacturers - Select 2021 high quality Cow Medicine products in best price from certified Chinese Injection, China Ego suppliers, wholesalers and factory on Made-in-China.com

    Get Price
  • Find Unimaginable Offers on Premium pharmaceutical ...

    15kg High Efficiency Cheap White Powder Povidone Iodine Poultry Farm Swine Veterinary Medicine For Dogs US 8.00-10.00 Kilogram 1000.0 Kilograms (Min. Order)

    Get Price
  • Diseases of Swine | Rent | 9781119350859 | Chegg.com

    2019-6-18 · Full Title: Diseases of Swine; Edition: 11th edition; ISBN-13: 978-1119350859; Format: Hardback; Publisher: Wiley-Blackwell (6/18/2019) Copyright: 2019; …

    Get Price
  • Review of clinical aspects, epidemiology and

    Mycoplasma ovis (formerly Eperythrozoon ovis) is an epierythrocytic parasitic bacterium of small ruminants known as haemotropic mycoplasma, which is transmitted mechanically by biting flies and contaminated instruments. Acute mycoplasmosis causes severe haemolytic anaemia and mortality in young animals. At the same time, chronic disease may produce ...

    Get Price
  • Lice in Pigs - Integumentary System - Merck

    Lice are vectors for disease such as swine pox. Lice can be treated and prevented with ivomec, brand name Ivermectin. This is the same medication, at the same dose, that is used to treat and prevent mites. See dosage here. Pigs get lice from other pigs. Swine lice are species specific and cannot live on any other animals or humans.

    Get Price
  • Mycoplasma haemolama In Camelids - Shagbark Ridge

    The importance of rapid, accurate and cheap DNA sequencing was illustrated in this project to identify the baseline reference genomes for the two myoplasmas studied and then to test the accuracy of the various component DNA sequences synthesized in vitro to build the synthetic bacterial genome. It is interesting to note that progress was temporarily stopped because of a single base pair deletion in an essential …

    Get Price
  • Mycoplasma mycoides - an overview | ScienceDirect

    2017-12-1 · The goal of this research was to develop a colloidal gold immunochromatographic strip test for detection of antibody to Mycoplasma wenyonii (M. wenyon…

    Get Price
  • Development of an antigen specific colloidal gold ...

    2021-7-2 · A synthetic oligonucleotide useful in detecting early Eperythrozoon suis infected blood by specifically priming an eperythrozoon specific polymerase chain reaction having the DNA sequence TCTTCAACTCTTCCTATGGA (SEQ ID NO: 1).

    Get Price
  • Specific pathogen free organisms. Medical search

    1998-1-1 · The disease rate is not only dependent on the host, but also on specific properties of the infectious agents. There are different strains of many viruses, with different organotropism (e.g. hepatotropic, enterotropic and neurotropic strains of the mouse hepatitis virus (MHV)).This influences the disease rate and the mortality, as well as the type and severity of pathological changes.

    Get Price
  • China Cefquinome Sulfate Injectable For

    2021-5-18 · Indications: Antipyretic and analgesic. used for treatment of muscle pain, rheumatism, febrile diseases, colic, etc. 1. Have special effects on high fever caused by bacteria and virus disease infection or mixed infection, such as eperythrozoon, toxoplasmosis, circovirus, infectious pleurisy,...

    Get Price
  • Doxycycline Hydrochloride Injectable For

    2021-5-18 · Indications: Antipyretic and analgesic. used for treatment of muscle pain, rheumatism, febrile diseases, colic, etc. 1. Have special effects on high fever caused by bacteria and virus disease infection or mixed infection, such as eperythrozoon, toxoplasmosis, circovirus, infectious pleurisy,...

    Get Price
  • China Compound Vitamin B Injectable For

    2021-5-18 · The organization keeps for the procedure concept 'scientific administration, superior quality and effectiveness primacy, shopper supreme for Compound Vitamin B Injectable For Horse/Pig/Swine, Hot Sale Veterinary Iron Dextran Injection, High Quality Veterinary Amoxicillin Injection, Iron Dextran And B12 Injectable, Accurate process devices, Advanced Injection Molding Equipment, Equipment ...

    Get Price
  • China Amoxicillin Injection For Livestock Factory -

    2021-5-18 · Cefquinome sulfate injection 2.5% product features: this product is a kind of suspension for injection containing 25mg/ml of cefquinome. it is rather potent against both gram positive bacteria and gram negative bacteria. its features in fast acting and strong penetration through the tissues ensure the fast and effective bactericidal action of this product. it is well tolerated in tissues and ...

    Get Price
  • China Butaphosphan And B12 Injection 10% For

    2021-5-18 · It can be our accountability to satisfy your preferences and competently provide you. Your satisfaction is our greatest reward. We are searching ahead towards your visit for joint growth for Butaphosphan And B12 Injection 10% For Animal Treatment, Sulfadiazine Sodium + Trimethoprim Suspension, Oxytetracycline Injectable, Florfenicol Injection 10% For Animal Treatment, At our firm …

    Get Price
  • Mycoplasma haemolama In Camelids - Shagbark Ridge

    2002-1-1 · Additional pathogens (Eperythrozoon sp., Haemobartonella sp., Encephalitozoon sp.) can contaminate biological materi- als after animal-to-animal passages (Petri, 1966; National Research Council, 1991) and thus may be transmitted to recipient animals.

    Get Price
  • Management of immunocompromised and infected

    1990 Volume 52 Issue 6 Pages 1147-1153 Published: December 15, 1990 Released: February 14, 2008

    Get Price
  • The Japanese Journal of Veterinary Science

    1998-1-1 · This chapter discusses the management of immunocompromized and infected animals. The microbiological quality of laboratory animals is a direct result of colony management practices, and monitoring provides an after-the-fact assessment of the adequacy of those practices. In the case of immunocompromised animals or in infection experiments ...

    Get Price
  • 1 Management of Immunocompromised and Infected

    The first and foremost is that many of these species have not been domesticated very long, relatively speaking. Some exotic species are first or second generation, and as such hav

    Get Price
  • China Cefquinome Sulfate Injectable For

    2021-5-18 · Indications: Antipyretic and analgesic. used for treatment of muscle pain, rheumatism, febrile diseases, colic, etc. 1. Have special effects on high fever caused by bacteria and virus disease infection or mixed infection, such as eperythrozoon, toxoplasmosis, circovirus, infectious pleurisy,...

    Get Price
  • China Compound Vitamin B Injectable For

    2021-5-18 · The organization keeps for the procedure concept 'scientific administration, superior quality and effectiveness primacy, shopper supreme for Compound Vitamin B Injectable For Horse/Pig/Swine, Hot Sale Veterinary Iron Dextran Injection, High Quality Veterinary Amoxicillin Injection, Iron Dextran And B12 Injectable, Accurate process devices, Advanced Injection Molding Equipment, Equipment ...

    Get Price
  • China Amoxicillin Injection For Livestock Factory -

    2021-5-18 · Cefquinome sulfate injection 2.5% product features: this product is a kind of suspension for injection containing 25mg/ml of cefquinome. it is rather potent against both gram positive bacteria and gram negative bacteria. its features in fast acting and strong penetration through the tissues ensure the fast and effective bactericidal action of this product. it is well tolerated in tissues and ...

    Get Price
  • China Butaphosphan And B12 Injection 10% For

    2021-5-18 · It can be our accountability to satisfy your preferences and competently provide you. Your satisfaction is our greatest reward. We are searching ahead towards your visit for joint growth for Butaphosphan And B12 Injection 10% For Animal Treatment, Sulfadiazine Sodium + Trimethoprim Suspension, Oxytetracycline Injectable, Florfenicol Injection 10% For Animal Treatment, At our firm …

    Get Price
  • (PDF) Farmers do not do what they know they should

    Academia.edu is a platform for academics to share research papers.

    Get Price
  • (PDF) The paraflagellar rod of kinetoplastids: A novel ...

    The paraflagellar rod of kinetoplastids: A novel therapeutic and prophylactic target. Download. The paraflagellar rod of kinetoplastids: A novel therapeutic and prophylactic target

    Get Price
  • (PDF) The Biology of Blood-Sucking in Insects,

    The Biology of Blood-Sucking in Insects, SECOND EDITION

    Get Price
  • Thank You for Your Support! - The Swift Team Blog

    2021-6-26 · mycoplasma pulmonis. Medical Information Search. English. English Español Português Français Italiano Svenska Deutsch

    Get Price
  • Mycoplasma pulmonis. Medical search

    The first and foremost is that many of these species have not been domesticated very long, relatively speaking. Some exotic species are first or second generation, and as such hav

    Get Price
  • China Cow Medicine, Cow Medicine Manufacturers,

    China Cow Medicine manufacturers - Select 2021 high quality Cow Medicine products in best price from certified Chinese Injection, China Ego suppliers, wholesalers and factory on Made-in-China.com

    Get Price
  • Find Unimaginable Offers on Premium pharmaceutical ...

    15kg High Efficiency Cheap White Powder Povidone Iodine Poultry Farm Swine Veterinary Medicine For Dogs US 8.00-10.00 Kilogram 1000.0 Kilograms (Min. Order)

    Get Price
  • Diseases of Swine | Rent | 9781119350859 | Chegg.com

    2019-6-18 · Full Title: Diseases of Swine; Edition: 11th edition; ISBN-13: 978-1119350859; Format: Hardback; Publisher: Wiley-Blackwell (6/18/2019) Copyright: 2019; …

    Get Price
  • Review of clinical aspects, epidemiology and

    Mycoplasma ovis (formerly Eperythrozoon ovis) is an epierythrocytic parasitic bacterium of small ruminants known as haemotropic mycoplasma, which is transmitted mechanically by biting flies and contaminated instruments. Acute mycoplasmosis causes severe haemolytic anaemia and mortality in young animals. At the same time, chronic disease may produce ...

    Get Price
  • Lice in Pigs - Integumentary System - Merck

    Lice are vectors for disease such as swine pox. Lice can be treated and prevented with ivomec, brand name Ivermectin. This is the same medication, at the same dose, that is used to treat and prevent mites. See dosage here. Pigs get lice from other pigs. Swine lice are species specific and cannot live on any other animals or humans.

    Get Price
  • Mycoplasma haemolama In Camelids - Shagbark Ridge

    2018-9-13 · Tetracycline is the treatment of choice, but what is unclear is if the tetracycline actually makes the organism go away, or if it doesn't just suppress the disease to undetectable levels. Then, if an animal carrying low levels of the organism gets stressed by shipping or by some other disease, the eperythrozoons can start multiplying again.

    Get Price
  • Mycoplasma mycoides - an overview | ScienceDirect

    The importance of rapid, accurate and cheap DNA sequencing was illustrated in this project to identify the baseline reference genomes for the two myoplasmas studied and then to test the accuracy of the various component DNA sequences synthesized in vitro to build the synthetic bacterial genome. It is interesting to note that progress was temporarily stopped because of a single base pair deletion in an essential …

    Get Price
  • Development of an antigen specific colloidal gold ...

    2017-12-1 · The goal of this research was to develop a colloidal gold immunochromatographic strip test for detection of antibody to Mycoplasma wenyonii (M. wenyon…

    Get Price
  • Specific pathogen free organisms. Medical search

    2021-7-2 · A synthetic oligonucleotide useful in detecting early Eperythrozoon suis infected blood by specifically priming an eperythrozoon specific polymerase chain reaction having the DNA sequence TCTTCAACTCTTCCTATGGA (SEQ ID NO: 1).

    Get Price
  • 1 Management of Immunocompromised and Infected

    1998-1-1 · The disease rate is not only dependent on the host, but also on specific properties of the infectious agents. There are different strains of many viruses, with different organotropism (e.g. hepatotropic, enterotropic and neurotropic strains of the mouse hepatitis virus (MHV)).This influences the disease rate and the mortality, as well as the type and severity of pathological changes.

    Get Price
  • Full article: The effect of Houttuynia cordata injection ...

    2011-1-25 · Because H. cordata is very cheap and easily available in China and it may be one prospective natural products that can be used for treating PrV infection. In fact, Houttuynia cordata injection (HCI), the physical salt solution of the steam distillate from plants of H. cordata has been used in the treatment of various ailments ( Lu et al., 2006 ).

    Get Price
  • Veterinary Treatment of Pigs | Wild Boar | Domestic Pig

    2019-10-22 · Veterinary Treatment of Pigs. I would like to dedicate this book to Alec Dawson MRCVS who was my guide and mentor when I first returned to general practice in the UK in 1975. Although he was in his late sixties he always kept updated and was always prepared to give helpful, friendly advice. I had only been working for him for 4 weeks when he suggested that my knowledge of pig medicine was ...

    Get Price
  • Veterinary Treatment of Pigs - Free Download PDF

    2018-3-22 · Veterinary Treatment of Pigs I would like to dedicate this book to Alec Dawson MRCVS who was my guide and mentor when I first returned to general practice in the UK in 1975.

    Get Price
  • Small Ruminant | Sepsis | Diseases And Disorders

    2013-12-19 · Small Ruminant - Free ebook download as PDF File (.pdf), Text File (.txt) or read book online for free.

    Get Price
  • EFSA Report on Dairy Cow Welfare Final | Animal

    2013-10-9 · For citation purposes: Scientific report of EFSA prepared by the Animal Health and Animal Welfare Unit on the effects of farming systems on dairy cow welfare and disease. Annex to the EFSA Journal (2009) 1143, 1-7. European Food Safety Authority, 2008 Effects of farming systems on dairy cow welfare and disease

    Get Price
  • Mycoplasma Diseases of Ruminants: - PDF Free

    Chapter 10: Bovine Respiratory Disease Overview Diseases caused by Mycoplasma bovis Other bovine mycoplasmoses 132 132 133 154 Chapter 11: Respiratory Diseases of Small Ruminants Overview Atypical pneumonia of sheep and goats Diseases caused by Mycoplasma mycoides subsp. capri and Mycoplasma mycoides subsp. mycoides LC In vitro susceptibility ...

    Get Price
  • 2012 Proceedings of 3rd ISOCARD Conference | Camel ...

    2017-8-9 · The disease can be infectious, caused as a result of physical injury to the mammary gland or contagious caused by microorganisms. The inflammatory responses result in higher blood proteins and white blood cells in the mammary tissues, which passes into the milk. The quality of milk is altered by changes in composition and by increase in somatic ...

    Get Price
  • assignment virology | Virus | Diseases And Disorders

    2021-3-28 · Scribd is the world's largest social reading and publishing site.

    Get Price
  • Treating mycoplasma in calves' Keyword Found

    Treating mycoplasma in calves keyword after analyzing the system lists the list of keywords related and the list of websites with related content, in addition you can see which keywords most interested customers on the this website

    Get Price
  • Tropical Anemia | Anemia | Malaria - Scribd

    2012-11-7 · This disease is a tick-borne disease [47 – 48]. Concerning cattle at present, intensive acaricidal tick control can now be supplemented by an attenuated schizont vaccine against T.annulata, while immunization against East Coast fever is carried out on a limited scale using virulent sporozoite infection and treatment [47].

    Get Price
  • latex bead agglutination: Topics by Science.gov

    2018-6-11 · This system is a logical outgrowth of some of the solid phase work done on MEMS and represents the next generation tests system that can be directly applied to early disease detection and monitoring. Agglutination of Mouse Erythrocytes by Eperythrozoon coccoides. PubMed Central. Iralu, Vichazelhu; Ganong, Kevin D. 1983-01-01

    Get Price
  • Veterinary Treatment of Pigs | Wild Boar | Domestic Pig

    2019-10-22 · Veterinary Treatment of Pigs. I would like to dedicate this book to Alec Dawson MRCVS who was my guide and mentor when I first returned to general practice in the UK in 1975. Although he was in his late sixties he always kept updated and was always prepared to give helpful, friendly advice. I had only been working for him for 4 weeks when he suggested that my knowledge of pig medicine was ...

    Get Price
  • Governo Federal - Governo do Brasil. — Português (Brasil)

    Preferred Method: In vaccinating swine against the effects of a high fever disease form of PRRS, the high fever disease form of PRRS is from a Chinese PRRS virus (PRRSV) that has a nucleic acid sequence that is at least 95% homologous to the nucleic acid sequence of HB-1, or JX143.

    Get Price
  • particle agglutination assay: Topics by Science.gov

    particle agglutination assay: Topics by Science.gov. Systems, devices, and methods for agglutination assays using sedimentation. DOEpatents. Schaff, Ulrich Y.; Sommer, Gregory J.; Singh, Anup K. 2016-01-26. Embodiments of the present invention include methods for …

    Get Price
  • Clinicopathologic Principles for Veterinary Medicine -

    Metabolic disease 389 David W. Pethick 7 The alimentary tract 163 John R. Bolton and David A. Pass 16 The reproductive system 399 Peter E. Williamson 8 The liver and exocrine pancreas Clive R. R. Huxtable 194 Index 419 Contributors John R. Bolton, B.V.Sc., Ph.D., M.A.C.V.Sc. Senior Lecturer in …

    Get Price
  • Manual - IDEXX laboratories - Studylib

    Farm Animal Medicine and Surgery For Small Animal Veterinarians I would like to dedicate this book to all the veterinary students that I have had the privilege of helping with their learning, starting with Shartry and Ramazan in Mombasa in 1967 and continuing through to my daughter Amelia in 2013.

    Get Price
  • Farm Animal Medicine and Surgery - Studylib

    2021-6-5 · In for ipad cheap magikarp plush italux lampa antonio instalar report viewer visual studio 2012 express md anderson katy imaging emergo movie wikipedia shadowrun novels mobi lav rental los angeles. By funk playful kiss season 2 eng sub gantiwarno matesih ngucapin ultah buat sahabat 03113 end-of-file on communication channel shanti ongenae?

    Get Price
  • abroad airport: 2021

    2018-11-26 · A total of 184 serum samples were tested for the presence of antibodies against swine hepatitis E virus (HEV), Aujeszky’s disease virus (ADV) and swine influenza virus (SIV). Detection of anti- HEV and anti-SIV antibodies was made using ID Screen® Hepatitis E indirect multi-species, respectively ID Screen® Influenza A antibody competition m ulti-species (ID.Vet, France).

    Get Price
  • vol_58_2015_3 - Scribd

    2018-11-26 · A total of 184 serum samples were tested for the presence of antibodies against swine hepatitis E virus (HEV), Aujeszky’s disease virus (ADV) and swine influenza virus (SIV). Detection of anti- HEV and anti-SIV antibodies was made using ID Screen® Hepatitis E indirect multi-species, respectively ID Screen® Influenza A antibody competition m ulti-species (ID.Vet, France).

    Get Price
  • Farm Animal Medicine and Surgery - Studylib

    Farm Animal Medicine and Surgery For Small Animal Veterinarians I would like to dedicate this book to all the veterinary students that I have had the privilege of helping with their learning, starting with Shartry and Ramazan in Mombasa in 1967 and continuing through to my daughter Amelia in 2013.

    Get Price
  • UNIVERSITATEA DE ȘTIINȚE AGRICOLE ȘI MEDICINĂ ...

    2019-2-7 · PMID- 13042607 TI - [Crural neuralgia]. PMID- 13042608 TI - [Amaurotic idiocy of Tay-Sachs]. PMID- 13042609 TI - [Acute reticuloendotheliosis in children]. PMID- 13042610 TI - [Im

    Get Price
  • Full article: The effect of Houttuynia cordata injection ...

    2011-1-25 · Because H. cordata is very cheap and easily available in China and it may be one prospective natural products that can be used for treating PrV infection. In fact, Houttuynia cordata injection (HCI), the physical salt solution of the steam distillate from plants of H. cordata has been used in the treatment of various ailments ( Lu et al., 2006 ).

    Get Price
  • Small Ruminant | Sepsis | Diseases And Disorders

    2013-12-19 · Small Ruminant - Free ebook download as PDF File (.pdf), Text File (.txt) or read book online for free.

    Get Price
  • Veterinary Treatment of Pigs - Free Download PDF

    2018-3-22 · Veterinary Treatment of Pigs I would like to dedicate this book to Alec Dawson MRCVS who was my guide and mentor when I first returned to general practice in the UK in 1975.

    Get Price
  • Veterinary Treatment of Pigs | Wild Boar | Domestic Pig

    2019-10-22 · Veterinary Treatment of Pigs. I would like to dedicate this book to Alec Dawson MRCVS who was my guide and mentor when I first returned to general practice in the UK in 1975. Although he was in his late sixties he always kept updated and was always prepared to give helpful, friendly advice. I had only been working for him for 4 weeks when he suggested that my knowledge of pig medicine was ...

    Get Price
  • Mycoplasma Diseases of Ruminants: - PDF Free

    Chapter 10: Bovine Respiratory Disease Overview Diseases caused by Mycoplasma bovis Other bovine mycoplasmoses 132 132 133 154 Chapter 11: Respiratory Diseases of Small Ruminants Overview Atypical pneumonia of sheep and goats Diseases caused by Mycoplasma mycoides subsp. capri and Mycoplasma mycoides subsp. mycoides LC In vitro susceptibility ...

    Get Price
  • SUMMARY - Our Illumination

    2020-8-30 · , 1985). Suicide plasmids are the plasmids which get transformed to another bacterial cell but do not replicate further (Austin, 1984). Resistance (R) plasmids are large conjugative plasmids that carry one or more antibiotic resistance genes (Hayes, 2000).

    Get Price
  • The Weaner Pig | Relative Humidity | Weaning

    2014-6-12 · The weaner pig : nutrition and management edited by M.A. Varley and J. Wiseman. Papers from the occasional Meeting of the British Society of Animal Science, held at Nottingham university, Sept. 2000. Piglets--Nutrition--Requirements--Congresses.

    Get Price
  • The Biology of Blood-Sucking in Insects | Parasitism |

    2015-8-17 · This page intentionally left blank. The Biology of Blood-Sucking in Insects Second Edition Blood-sucking insects transmit many of the most debilitating diseases in humans, including malaria, sleeping sickness, filariasis, leishmaniasis, dengue, typhus and plague. In addition, these insects cause major economic losses in agriculture both by direct damage to livestock and as a result of the ...

    Get Price
  • Treating mycoplasma in calves' Keyword Found

    Treating mycoplasma in calves keyword after analyzing the system lists the list of keywords related and the list of websites with related content, in addition you can see which keywords most interested customers on the this website

    Get Price
  • palestras helmintos - veterinary medicine

    palestras helmintos PALESTRAS HELMINTOS RESISTÊNCIA GENÉTICA ÀS INFECÇÕES PARASITÁRIAS ALESSANDRO F. T. AMARANTE1 ABSTRACT:- AMARANTE, A.F.T. [Genetic resistance against parasitic infections] The control of gastrointestinal nematodes in ruminants has been jeopardized by the appearance of nematode populations with resistance to anthelmintics.

    Get Price
  • vol_58_2015_3 - Scribd

    2018-11-26 · A total of 184 serum samples were tested for the presence of antibodies against swine hepatitis E virus (HEV), Aujeszky’s disease virus (ADV) and swine influenza virus (SIV). Detection of anti- HEV and anti-SIV antibodies was made using ID Screen® Hepatitis E indirect multi-species, respectively ID Screen® Influenza A antibody competition m ulti-species (ID.Vet, France).

    Get Price
  • Clinicopathologic Principles for Veterinary Medicine -

    Metabolic disease 389 David W. Pethick 7 The alimentary tract 163 John R. Bolton and David A. Pass 16 The reproductive system 399 Peter E. Williamson 8 The liver and exocrine pancreas Clive R. R. Huxtable 194 Index 419 Contributors John R. Bolton, B.V.Sc., Ph.D., M.A.C.V.Sc. Senior Lecturer in …

    Get Price
  • Farm Animal Medicine and Surgery - Studylib

    Farm Animal Medicine and Surgery For Small Animal Veterinarians I would like to dedicate this book to all the veterinary students that I have had the privilege of helping with their learning, starting with Shartry and Ramazan in Mombasa in 1967 and continuing through to my daughter Amelia in 2013.

    Get Price
  • abroad airport: 2021

    2021-6-5 · In for ipad cheap magikarp plush italux lampa antonio instalar report viewer visual studio 2012 express md anderson katy imaging emergo movie wikipedia shadowrun novels mobi lav rental los angeles. By funk playful kiss season 2 eng sub gantiwarno matesih ngucapin ultah buat sahabat 03113 end-of-file on communication channel shanti ongenae?

    Get Price
  • UNIVERSITATEA DE ȘTIINȚE AGRICOLE ȘI MEDICINĂ ...

    2019-2-7 · PMID- 13042607 TI - [Crural neuralgia]. PMID- 13042608 TI - [Amaurotic idiocy of Tay-Sachs]. PMID- 13042609 TI - [Acute reticuloendotheliosis in children]. PMID- 13042610 TI - [Im

    Get Price